

Apuntes y esquemas

Biología - EBAU - IVb - Genética Molecular

En la EBAU

  • Es la 4ª pregunta de la 2ª opción.
  • 2,5 puntos.
  • Temas 16, 17 y 19 (1 a 3) de nuestro libro de texto.


  1. Observe la siguiente imagen y responda: (a) ¿Qué proceso es? ¿En qué parte de la célula ocurre? (0,4). (b) Nombre cada uno de los elementos marcados con números que participan en este proceso ¿Qué fases tiene este proceso? (1,0). (c) Indique la función de los elementos señalados con el número 2 y 3 (0,6).
  2. Con respecto al esquema de la derecha: (a) ¿Qué proceso representa? Identificar los elementos señalados con los números (1, 2 y 3) (0,8). (b) ¿Qué enzima es la principal responsable de este proceso y cómo actúa? (0,4). (c) ¿Qué etapas existen en este proceso? Descríbalas brevemente (0,8).


  1. (a) En el DNA de doble hebra de ciertas células bacterianas, el 33% de las bases son citosinas. ¿Cuáles son los porcentajes de las otras bases? (0,90) (b) Enumerar dos enzimas que participen en el proceso de replicación de DNA. Describir brevemente su función. (0,90). (c) A partir del fragmento de mRNA que se indica a continuación, obtener la secuencia de la hebra molde del DNA del que procede por transcripción y de la hebra codificante o informativa (0,70): 5'…CCAUGAUUGGCCAAGUAUGCGAAA…3'. (d) Diferenciar mutación génica y genómica. Incluir un ejemplo de cada una. (0,75)
  2. En relación a las mutaciones: (a) Suponga que en un fragmento de DNA que codifica un polipéptido se produce una mutación que cambia un par de bases por otro. Indique razonadamente al menos 3 posibles consecuencias de esta mutación en el polipéptido que se sintetiza a partir de este DNA mutado. (1,6) (b) Defina mutación puntual, cromosómica y genómica y ponga un ejemplo de cada una. (0,9)


  1. Para la siguiente cadena de DNA no codificante: 5'... AGTCATAACCTACAAAGCAG ...3' (a) Si su secuencia complementaria da lugar a un mRNA ¿Cuál sería la secuencia de ese mRNA? (0,50). (b) ¿Qué enzima cataliza la síntesis de mRNA a partir de DNA? Explicar las modificaciones postranscripcionales del mRNA? (1,5). (c) En relación a los siguientes componentes, indica las diferencias entre células procariotas y eucariotas: genes, cromosomas, ARN polimerasa, localización de la transcripción y traducción y ribosomas (0,50).
  2. En relación al proceso de síntesis de proteínas en una célula: (a) ¿Qué nombre recibe este proceso? ¿Cómo se inicia y finaliza? (0,5). (b) ¿Qué papel tienen en dicho proceso los siguientes elementos: DNA, mRNA, tRNA, ribosomas y la aminoacil-tRNA-sintetasa? (1,5). (c) ¿En qué lugares de la célula se produce? (0,5).


  1. Observe la siguiente figura sobre un proceso que sucede en una célula eucariota: (a) ¿De qué proceso se trata y en qué sentido se produce? ¿Qué etapas tiene dicho proceso y qué ocurre en cada una de ellas? (1,0). (b) ¿A qué elementos corresponden cada uno de los números indicados? (0,5). (c) ¿Qué tipos de RNA intervienen en este proceso y cuál es la función de cada uno de ellos? (1,0).
  2. El siguiente segmento de ARNm codifica un segmento de un polipéptido (los diferentes codones aparecen subrayados): 5'... AAU CUU AAC UCU ACA AAG CAG ...3'. (a) Determinar la secuencia de las dos hebras del segmento de ADN del que proviene este ARN (0,50). (b) Indicar cómo podría originarse un codón de terminación de la síntesis mediante las siguientes mutaciones en el segmento de ADN considerado: (i) adición de una sola base; (ii) substitución de una sola base. (0,50). (c) ¿Qué diferencias existen entre traducción y transcripción? y ¿entre codón y anticodón? (1,0). (d) En qué parte de las células procariotas y eucariotas tienen lugar los procesos de replicación, transcripción y traducción? (0,50).


  1. En relación al código genético responder a las siguientes cuestiones: (a) Escriba la secuencia de una cadena con la que podría formar una doble hélice el segmento de ADN siguiente: 5'-ATTCTTGGCATTCGC-3'. Si se iniciara la replicación de la secuencia dada, con un fragmento de Okazaki, explique ayudándose de un dibujo, en qué sentido avanzaría la replicación (4). (b) Dado el segmento de una cadena de ADN siguiente: 3'-TACAAGTTTGGTTACTTG-5': ¿Cuál sería la secuencia de bases en una cadena de ARNm transcrita a partir de ese segmento de ADN? ¿Cuál sería la secuencia de aminoácidos codificada por el ARNm? (6).
  2. En relación con la replicación: (a) Defina en qué consiste y nombre la enzima encargada de este proceso (2). (b) Explique por qué se dice que es semiconservativa, bidireccional y asimétrica.(5). (c) Defina horquilla de replicación, cebador y fragmentos de Okazaki (3).


  1. (a) Identificar los procesos celulares (A), (B) y (C) e indicar la ubicación celular de estos procesos en células eucariotas y procariotas (4).(b) La hebra molde de la región codificante de un gen eucariota que codifica para ARNm contiene la siguiente proporción de bases nitrogenadas: A = 24,7%, G = 26,0%, C = 25,7% y T = 23,6%. Indicar cuál será la proporción de bases del ARNm transcrito primario. ¿Esta proporción será la misma en el ARNm maduro? Razonar la respuesta (3). (c) Definir los siguientes conceptos: delección, aneuploidía y poliploidia (3).
  2. Respecto a la transcripción: (a) Explique en qué consiste e indique el enzima que lleva a cabo este proceso. Cite las etapas en las que se divide este proceso (5). (b) Indique dos diferencias entre la transcripción en procariotas y en eucariotas (2). (c) Defina promotor, burbuja de transcripción e intrón (3).


  1. En relación al material genético conteste a las siguientes cuestiones: (a) Defina los términos replicación semiconservativa y topoisomerasa (2). (b) Explique dos características del código genético (2). (c) Defina mutación génica y mutación cromosómica (2). (d) Indique el orgánulo y las moléculas que intervienen en el proceso de traducción y enumere sus etapas (4).
  2. En relación al proceso de replicación: (a) Realice un dibujo e identifique en él todos los componentes que participan tanto en la cadena conductora como en la retrasada (4). (b) ¿Por qué la síntesis es continua en una de las cadenas y discontinua en la otra? (2). (c) Si se produce una mutación puntual por sustitución de una base por otra distinta, ¿qué alteraciones esperaríamos encontrar? (2). (d) Cite alguna enzima que participe en la reparación del DNA y señale su función (2).


  1. En relación al material genético y su metabolismo: (a) Indique que es el código genético y explique qué quiere decir que está degenerado. (b) Defina el proceso de transcripción e indique sus etapas. (c) Indique qué son los fragmentos de Okazaki y qué enzima se encarga de su síntesis. (d) Señale las modificaciones durante la maduración de un transcrito primario de mRNA de eucariotas. (e) Escriba la secuencia de mRNA a partir de la siguiente secuencia de DNA e indique cuál es el número máximo de aminoácidos que puede codificar y explíquelo razonadamente: 3'- CCATTGGGCCACCAGGAT-5'.
  2. Responda sobre la traducción: (a) ¿Cuál es la función de estos elementos en dicho proceso?: Ribosoma, ARNm, ARNt, anticodón, sitio peptídico (5). (b) ¿Cuáles son las fases de dicho proceso? (3). (c) ¿Todas las proteínas recién sintetizadas en eucariotas poseen metionina en su extremo N-terminal? Razone la respuesta (2).


  1. En relación con la información genética y sus alteraciones: (a) Si un polipéptido tiene 110 aminoácidos, indica cuántos nucleótidos tendrá el fragmento del ARNm que codifica a esos aminoácidos. Razone la respuesta (1). (b) ¿Qué significa que el código genético está degenerado? (1). (c) En un fragmento de ADN que codifica a un polipéptido se produce una mutación puntual, que afecta a un par de bases. Cuando la célula sintetice el polipéptido, a éste le podría haber ocurrido uno de los cuatro hechos de más abajo. Basándote en tus conocimientos del código genético, explica por qué puede darse cada uno de estos resultados (8).

    • Que se codifique el mismo aminoácido que el sintetizado antes de la mutación.
    • Que un aminoácido sea sustituido por otro.
    • Que el nuevo polipéptido sintetizado sea más corto.
    • Que el nuevo polipéptido sintetizado sea más largo.
  2. (a) Indique las funciones de las siguientes enzimas que participan en la replicación del ADN: helicasa y topoisomerasa (2). (b) ¿Qué es la transcripción? Indique y explique brevemente sus etapas (5). (c) Transcriba la siguiente secuencia de ADN (2): 5'- GCCGTATGCCCATAG-3'. (d) ¿Qué nombre reciben las secuencias de inicio a las que se une la ARN polimerasa? (1).


  1. Observa el siguiente segmento de ADN:

    5' G C T T C C C A A 3'
    3' C G A A G G G T T 5'

    (a) Escribe la molécula de ARN que se transcribiría a partir de este segmento. Considera que la ARN polimerasa usa la hebra superior como molde cuando va a sintetizar ARN. Marca los extremos 5' y 3' del ARN (2). (b) Consultando el código genético, escribe la secuencia de aminoácidos que se produciría al traducir este ARN. Marca los extremos carboxilo y amino de este péptido (2). (c) Repite la operación asumiendo ahora que la hebra usada como molde por la ARN polimerasa es la inferior (4). (d) Con esta información, ¿Podrías saber a ciencia cierta cuál de las dos cadenas de este fragmento de ADN se usa como molde? Explica por qué (2).

  2. (a) Dado el siguiente fragmento de ADN monocatenario 3'…TAC GGA GAT TCA AGA GAG …5' y del correspondiente ADN mutante 3'… TAC GGG ATT CAA GAG AG…5' ¿Qué tipo de mutación se ha producido? (3). (b) ¿La mutación incluida en el apartado (a) puede conllevar alteraciones graves? Razona la respuesta (2). (c) Indicar qué son las aneuploidías y euploidías (2). (d) Poner tres ejemplos de agentes mutágenos exógenos (3).