J

Clases

Apuntes, esquemas, actividades...

Biología - EBAU - IVb - Genética Molecular - Respuestas

18 de mayo de 2022, por Arturo J. Murias

2021

1. Respecto a los mecanismos de expresión génica en eucariotas: (a) Escribir la secuencia de ARN sintetizada a partir de una cadena de ADN codificante que presenta la siguiente secuencia: 5'-ATCGTACCGTTACGATATAGT-3'. (b) Nombrar la enzima que realiza el proceso (0,75). (c) Si en un fragmento de ADN que codifica para una proteína se produce un cambio de una base adenina por una timina, explique qué tipo de modificación se produce (0,50). (d) Explique las posibles consecuencias que tendría la modificación del apartado anterior sobre la proteína codificada por este fragmento de ADN (0,75).

(a) 3'-UAGCAUGGCAAUGCUAUAUCA-5'

(b) Polimerasa de ARN.

(c) Una mutación génica del tipo de las sustituciones.

(d)

  • Si la sustitución da lugar a un triplete que codifica para el mismo aminoácido, no hay consecuencia alguna.
  • Si la sustitución afecta a un codón de terminación, el polipéptido tendrá aminoácidos de más y su función se vería totalmente alterada.
  • Si la sustitución afecta a un codón de iniciación, el polipéptido dejaría de sintetizarse.
  • Y si la sustitución cambia un aminoácido por otro, las consecuencias dependerán de si el aminoácido afectado es esencial en la conformación de la enzima o no; en el caso de que lo sea, la proteína puede perder su forma si, por ejemplo, se sustituye un aminoácido con carga positiva en su cadena lateral por uno neutro o con carga negativa; entonces, al perder su forma, perderá también su función.

2. (a) Identifica y define los procesos A, B y C de la figura e indica a qué moléculas corresponden los números 1, 2 y 3 (1.4). (b) Relaciona los siguientes elementos con el proceso que corresponda, A, B o C (0.6): Aminoacil-tRNA sintetasa; DNA Ligasa; DNA polimerasa; Fragmento de Okazaki; Primasa; RNA polimerasa.

(a)

  • A: Replicación.
  • B: Transcripción.
  • C: Traducción.
  • 1: ARN ribosómico.
  • 2: ARN mensajero.
  • 3: ARN de transferencia.

(b)

  • Aminoacil-tRNA sintetasa: Traducción.
  • DNA-ligasa: Replicación.
  • DNA-polimerasa: Replicación.
  • Fragmento de Okazaki: Replicación.
  • Primasa: Replicación.
  • RNA-polimerasa: Transcripción.

2020

1. Observe la siguiente imagen y responda: (a) ¿Qué proceso es? ¿En qué parte de la célula ocurre? (0,4). (b) Nombre cada uno de los elementos marcados con números que participan en este proceso (0,6). (c) ¿Qué fases tiene este proceso? (0,4). (d) Indique la función de los elementos señalados con el número 2 y 3 (0,6).

(a)

  • Es la traducción, enmarcada en la biosíntesis de proteínas.
  • En los ribosomas, que están:
    • libres en el citosol;
    • asociados a la cara externa de la envoltura nuclear;
    • asociados a la cara externa del retçiculo endoplasmático rugoso;
    • en la matriz mitocondrial;
    • en el estroma de los cloroplastos.

(b)

  1. Péptido.
  2. ARN de transferencia.
  3. ARN mensajero.
  4. Anticodón.
  5. Ribosoma (subinidad mayor).
  6. Codón.

(c) Iniciación, elongación y terminación.

(d)

  • ARN de transferencia: porta cada aminoácido que va a formar parte del polipéptido que se está polinerizando.
  • ARN mensajero: porta la secuencia de codones que determinarán que moléculas de aminoacil-ARNt se asociarán a él por sus anticodones y, por tanto, que aminoácidos se formarán parte del polipéptido.

2. Con respecto al esquema de la derecha: (a) ¿Qué proceso representa? Identificar los elementos señalados con los números (1, 2 y 3) (0,8). (b) ¿Qué enzima es la principal responsable de este proceso y cómo actúa? (0,4). (c) ¿Qué etapas existen en este proceso? Descríbalas brevemente (0,8).

(a)

  • La transcripción del ARN.
  • Hebra patrón de ADN.
  • Hebra codificante de ADN.
  • Molécula de ARN.

(b)

  • Polimerasa de ARN.
  • Polimeriza moléculas de ARN a partir de un molde de ADN utilizando ribonucleótidos-trifosfato libres a los que hidroliza hasta NMP y 2 Pi, de lo que obtiene la energía necesaria para la síntesis.

(c)

  • Iniciación:
    • La ARN-polimerasa se asocia a una región del ADN denominada promotor situada al lado del extremo 3' del gen que se va a transcribir.
    • La ARN-polimerasa desenrolla entre 1 y 2 vueltas de la doble hélice de ADN. De las dos hebras de la región de ADN que se va a transcribir, una se denomina cadena de ADN patrón, y es la que contiene la secuencia promotora a la que se ha asociado la polimerasa, y la que va a servir como molde del ARN que va a ser sintetizado por la ARN-polimerasa, al ir esta añadiendo uno a uno los nucleótidos complementarios a los del gen. La otra se denomina hebra codificante.
    • La ARN-polimerasa añade el primer nucleótido.
  • Alargamiento:
    • La ARN-polimerasa se va desplazando a lo largo del gen en sentido 3→5', al tiempo que va fabricando la cadena de ARN en sentido 5→3'.
    • Lo hace añadiendo uno a uno los nucleótidos complementarios a los del gen, tras lo cual fabrica el enlace fosfodiéster entre el nuevo nucleótido y el nucleótido del extremo 3' de la cadena de ARN en crecimiento.
    • La cadena de ARN va creciendo por su extremo 3', mientras que por su extremo 5' se va separando de la cadena de ADN patrón.
    • Al tiempo el ADN se va desespiralizando allí donde va llegando la polimerasa y reespiralizándose por la parte que va quedando detrás.
  • Terminación:
    • Cuando la ARN-polimerasa alcanza la secuencia de terminación del gen, se separa de la cadena de ADN patrón, y también lo hace la molécula de ARN que se ha sintetizado.

2019

1. (a) En el DNA de doble hebra de ciertas células bacterianas, el 33% de las bases son citosinas. ¿Cuáles son los porcentajes de las otras bases? (0,90) (b) Enumerar dos enzimas que participen en el proceso de replicación de DNA. Describir brevemente su función. (0,90). (c) A partir del fragmento de mRNA que se indica a continuación, obtener la secuencia de la hebra molde del DNA del que procede por transcripción y de la hebra codificante o informativa (0,70): 5'…CCAUGAUUGGCCAAGUAUGCGAAA…3'. (d) Diferenciar mutación génica y genómica. Incluir un ejemplo de cada una (0,75).

(a) G: 33%; A: 17%; T: 17%.

(b)

  • ADN-polimerasa III: va añadiendo nucleótidos al extremo 3' de la hebra hija en crecimiento en función de la complementariedad del nucleótido a añadir con cada nucleótido de la hebra materna (enfrente de dAMP coloca dTMP; enfrente de dCMP coloca dGMP; etc.), tras lo cual fabrica el enlace fosfodiéster entre el nuevo nucleótido y el nucleótido del extremo 3' de la hebra en crecimiento.
  • ADN-ligasa: se encarga de empalmar los diversos fragmentos de ADN de la hebra retardada, fabricando enlaces fosfodiéster entre el nucleótido del extremo 3' de un fragmento y el nucleótido del extremo 5' del fragmento de Okazaki contiguo.

(c)

  • Hebra molde: 3'...GGTACTAACCGGTTCATACGCTTT...5'.
  • Hebra codificante: 5'…CCATGATTGGCCAAGTATGCGAAA…3'.

2. En relación a las mutaciones: (a) Suponga que en un fragmento de DNA que codifica un polipéptido se produce una mutación que cambia un par de bases por otro. Indique razonadamente al menos 3 posibles consecuencias de esta mutación en el polipéptido que se sintetiza a partir de este DNA mutado. (1,6) (b) Defina mutación puntual, cromosómica y genómica y ponga un ejemplo de cada una. (0,9)

(a)

  • Si la sustitución da lugar a un triplete que codifica para el mismo aminoácido, no hay consecuencias.
  • Si la sustitución afecta a un codón de terminación, el polipéptido tendrá aminoácidos de más y su función se vería totalmente alterada.
  • Si la sustitución afecta a un codón de iniciación, el polipéptido dejaría de sintetizarse.
  • Y si la sustitución cambia un aminoácido por otro, las consecuencias dependerán de si el aminoácido afectado es esencial en la conformación de la enzima o no; en el caso de que lo sea, la proteína puede perder su forma si, por ejemplo, se sustituye un aminoácido con carga positiva en su cadena lateral por uno neutro o con carga negativa; entonces, al perder su forma, perderá también su función.

(b)

  • Mutación puntual o génica: aquella que afecta a uno o más nucleótidos de un gen, como una sustitución de una base por otra.
  • Mutación cromosómica: aquella que afecta a la estructura de un cromosoma, tal como la pérdida de algún segmento cromosómico (delección).
  • Mutación genómica o cariotípica: aquella que afecta al número de cromosomas de un cariotipo, como la trisomía en el par XXI, que causa el síndrome de Down.

2018

1. Para la siguiente cadena de DNA no codificante: 5'... AGTCATAACCTACAAAGCAG ...3' (a) Si su secuencia complementaria da lugar a un mRNA ¿Cuál sería la secuencia de ese mRNA? (0,50). (b) ¿Qué enzima cataliza la síntesis de mRNA a partir de DNA? Explicar las modificaciones postranscripcionales del mRNA? (1,5). (c) En relación a los siguientes componentes, indica las diferencias entre células procariotas y eucariotas: genes, cromosomas, ARN polimerasa, localización de la transcripción y traducción y ribosomas (0,50).

(a) 5'... AGUCAUAACCUACAAAGCAG ...3'

(b)

  • Polimerasa de ARN.
  • Al extremo 5' del ARNm se le añade una caperuza formada por el nucleótido 7-metil-GTP, que permitirá el anclaje del ARNm al ribosoma para la traducción.
  • Al extremo 3' del ARNm se le añade una cola de poli-A, que es una secuencia de unos 200 AMP que ayudan a evitar su degradación rápida en el citoplasma.
  • Todos los ARNm contienen intrones, porque los contenían también los genes a partir de los cuales han sido transcritos. Y hay que eliminarlos antes de que el ARNm pueda ser traducido en los ribosomas. Esto se hace en un proceso llamado maduración, que tiene 2 fases: 1º: un enzima, llamado espliceosoma, se une a los extremos de cada intrón, y lo extirpa del ARNm; 2º: una enzima ligasa empalma los exones.

(c)

  • Los genes procarióticos carecen de intrones.
  • Los cromosomas procarióicos son circulares y no están empaquetados por histonas; los eucarióticos son lineales y contienen histonas.
  • Los procariontes tienen una sola polimerasa de ARN, los eucariontes tienen 3.
  • En eucariontes la transcripción tiene lugar en el núcleo (y mitocondrias y cloroplastos); en procariontes todo sucede en el citoplasma.
  • Los ribosomas procarióticos son 70 S y los procarióticos 80 S.

2. En relación al proceso de síntesis de proteínas en una célula: (a) ¿Qué nombre recibe este proceso? ¿Cómo se inicia y finaliza? (0,5). (b) ¿Qué papel tienen en dicho proceso los siguientes elementos: DNA, mRNA, tRNA, ribosomas y la aminoacil-tRNA-sintetasa? (1,5). (c) ¿En qué lugares de la célula se produce? (0,5).

(a)

  • Traducción.
  • El paso previo consiste en la activación de los aminoácidos (su unión al ARNt que le corresponda en función de su anticodon, para formar un aminoacil-ARNt con gasto de ATP).
  • La traducción en sí se inicia con la unión del extremo 5' del ARNm a la subunidad menor del ribosoma, el ensamblaje del ribosoma, la unión del metionil-ARNt al ARNm cuando su codón 5'-AUG-3' está en el sitio A del ribosoma, y el desplazamiento del ribosoma sobre el ARNt hasta que el metionil-ARNt quede en el sitio P. A a esto se le llama complejo iniciador.
  • La traducción finaliza cuando en el sito A hay un codón de terminación (UAA, UAG, UGA): a este no se une ningún aminoacil-ARNt (no lo hay) y sí los factores de liberación; entonces se separan el polipéptido, el ARNm y las 2 subunidades ribosómicas.

(b)

  • ADN: contiene un gen, cuya hebra patrón sirve como molde para sintetizar en la transcripción el ARNm que será traducido en el ribosoma.
  • ARNm: contiene una secuencia de codones (tripletes de nucleótidos) que serán traducidos a los aminoácidos de un polipéptido en el ribosoma.
  • ARNt: lleva cada aminoácido al ribosoma, para que se añada al extremo C-terminal del polipéptido en crecimiento.
  • Ribosoma: es el "entorno molecular" en el que a los codones de un ARNm se le unen los aminoacil-ARNt correspondientes mediante su desplazamiento, triplete a triplete, sobre aquel.
  • Aminoacil-ARNt sintetasa: enzima que cataliza la unión de cada aminoácido al ARNt que le corresponde por su anticodón, con el gasto de un ATP hasta AMP.

(c) En el citosol. Y en las células eucarióticas, también en las mitocondrias y en los cloroplastos.


2017

1. Observe la siguiente figura sobre un proceso que sucede en una célula eucariota: (a) ¿De qué proceso se trata y en qué sentido se produce? ¿Qué etapas tiene dicho proceso y qué ocurre en cada una de ellas? (1,0). (b) ¿A qué elementos corresponden cada uno de los números indicados? (0,5). (c) ¿Qué tipos de RNA intervienen en este proceso y cuál es la función de cada uno de ellos? (1,0).

(a)

  • Traducción.
  • El ARNm es leído desde su extremo 5' a su extremo 3'.
  • Paso previo: Activación de los aa'. [Visto]
  • Primer paso: Iniciación. [Visto]
  • Segundo paso: Elongación. El ribosoma se va desplazando, triplete a triplete, sobre el ARNm, de 5' a 3', de modo que a cada paso (translocación) un nuevo codón ocupa el sitio A; a él llega un nuevo aminoacil-ARNt, cuyo aa', con ayuda de una peptidil-transferasa se une al extremo C-terminal del péptido en formación, que estaba en el sitio P, y que se suelta del ARNt que lo portaba, el cual se separa a su vez del ribosoma. Todo ello con consumo de GTP.
  • Tercer paso: Terminación. [Visto]

(b)

1: subunidad ribosómica mayor. 2: subunidad ribosómica menor. 3: codón de iniciación. 4: ARNm. 5: Polipéptido en formación. 6: codón de terminación.

(c)

  • ARNr: forma parte del ribosoma, y a él se une el ARNm que va a ser traducido.
  • ARNm: contiene una secuencia de codones (tripletes de nucleótidos) que serán traducidos a los aminoácidos de un polipéptido en el ribosoma.
  • ARNt: lleva cada aminoácido al ribosoma, para que se añada al extremo C-terminal del polipéptido en crecimiento.

2. El siguiente segmento de ARNm codifica un segmento de un polipéptido (los diferentes codones aparecen subrayados): 5'... AAU CUU AAC UCU ACA AAG CAG ...3'. (a) Determinar la secuencia de las dos hebras del segmento de ADN del que proviene este ARN (0,50). (b) Indicar cómo podría originarse un codón de terminación de la síntesis mediante las siguientes mutaciones en el segmento de ADN considerado: (i) adición de una sola base; (ii) substitución de una sola base. (0,50). (c) ¿Qué diferencias existen entre traducción y transcripción? y ¿entre codón y anticodón? (1,0). (d) En qué parte de las células procariotas y eucariotas tienen lugar los procesos de replicación, transcripción y traducción? (0,50).

(a)

  • 5'... AAT CTT AAC TCT ACA AAG CAG ...3' Hebra codificante
  • 3'... TTA GAA TTG AGA TGT TTC GTC ...5' Hebra patrón

(b)

  • Referimos todas a la hebra patrón, y empezamos a contar desde el extremo 3':
  • Adición de una A en el 1º lugar. El primer codógeno será ATT, que dará un codón UAA.
  • Sustitución de la 16ª T por una A. El sexto codógeno será ATC, que dará un codón UAG.

(c)

Transcripción Traducción
Qué se lee Una hebra de un ADN bicatenario ARNm
Qué se produce ARN Polipéptidos

Los codones son los tripletes de nucleótidos de la región codificante de un ARNm; el código genético está referido a ellos. Un anticodón es el triplete central del bucle central de un ARNt (y sólo hay un anticodón en cada ARNt), y determina a qué aa' se va a unir ese ARNt cuando se active.

(d)

Replicación Transcripción Traducción
Eucariontes Núcleo Núcleo Citoplasma (citosol, mitocondrias, cloroplastos)
Procariontes Citoplasma Citoplasma Citoplasma

2016

1. En relación al código genético responder a las siguientes cuestiones: (a) Escriba la secuencia de una cadena con la que podría formar una doble hélice el segmento de ADN siguiente: 5'-ATTCTTGGCATTCGC-3'. Si se iniciara la replicación de la secuencia dada, con un fragmento de Okazaki, explique ayudándose de un dibujo, en qué sentido avanzaría la replicación (4). (b) Dado el segmento de una cadena de ADN siguiente: 3'-TACAAGTTTGGTTACTTG-5': ¿Cuál sería la secuencia de bases en una cadena de ARNm transcrita a partir de ese segmento de ADN? ¿Cuál sería la secuencia de aminoácidos codificada por el ARNm? (6).

(a)

  • La cadena complementaria sería: 3' TAAGAACCGTAAGCG 5'.
  • Como la polimerasa de ADN sintetiza en sentido 5' a 3', para que la cadena copia de la que nos dan sea parte de la hebra retardada, la horquilla de replicación ha de quedar a la derecha, y la hebra hija, al crecer de 5' a 3', se sintetizaría de derecha a izquierda. Pero avanzaría, igual que la hebra conductora, hacia la derecha, que es el sentido de avance de la horquilla.

(b)

  • ARNm: 5' AUG UUC AAA CCA AUG AAC 3'.
  • Péptido: NH3+-Met-Phe-Lys-Pro-Met-Asn-COO-. (No pongas los extremos si no estás seguro/a).

2. En relación con la replicación: (a) Defina en qué consiste y nombre la enzima encargada de este proceso (2). (b) Explique por qué se dice que es semiconservativa, bidireccional y asimétrica (5). (c) Defina horquilla de replicación, cebador y fragmentos de Okazaki (3).

(a)

  • Replicación: proceso por el cual a partir de una molécula de ADN bicatenaria se obtienen dos moléculas de ADN con la misma secuencia de bases.
  • ADN polimerasa.

(b)

  • Semiconservativo: cada una de las 2 moléculas de ADN obtenidas contiene una cadena recién sintetizada y otra cadena procedente de la molécula original.
  • Bidireccional: el avance de las hebras hijas tiene lugar tanto en sentido 5' a 3' como en sentido 3' a 5'.
  • Asimétrica: mientras que la hebra que avanza en sentido 5' a 3' se sintetiza de forma continua (hebra conductora), la que avanza en sentido de 3' a 5' lo hace de forma discontinua (hebra retardada), debido a que la polimerasa de ADN sólo sintetiza en dirección 5' a 3'.

(c)

  • Horquilla de replicación: cada uno de los 2 extremos de una burbuja de replicación; son los lugares de crecimiento de cada hebra hija de ADN durante la replicación.
  • Cebador: pequeña molécula de ARN que va a permitir el inicio de la síntesis de una nueva cadena de ADN.
  • Fragmento de Okazaki: cada uno de los fragmentos de ADN que se sintetizan de manera discontinua en la hebra retardada, durante la replicación del ADN.

2015

1. (a) Identificar los procesos celulares (A), (B) y (C) e indicar la ubicación celular de estos procesos en células eucariotas y procariotas (4).(b) La hebra molde de la región codificante de un gen eucariota que codifica para ARNm contiene la siguiente proporción de bases nitrogenadas: A = 24,7%, G = 26,0%, C = 25,7% y T = 23,6%. Indicar cuál será la proporción de bases del ARNm transcrito primario. ¿Esta proporción será la misma en el ARNm maduro? Razonar la respuesta (3). (c) Definir los siguientes conceptos: delección, aneuploidía y poliploidia (3).

(a)

A B C
Nombre Replicación Transcripción Traducción
Eucariontes Núcleo Núcleo Citoplasma (citosol, mitocondrias, cloroplastos)
Procariontes Citoplasma Citoplasma Citoplasma

(b)

  • A = 23,6 %, G = 25,7 %, C = 26,0 %, U = 24,7 %.
  • En eucariontes los intrones de los genes se transcriben pero no se traducen, por lo que son eliminados durante el proceso de maduración, y las proporciones de bases anteriores no se van a conservar.

(c)

  • Delección: mutación bien de tipo génico, bien de tipo cromosómico (estructural) por el que se pierde un fragmento del gen o del cromosoma, respectivamente.
  • Aneuploidía: mutación cariotípica (= cromosómica numérica) por la que se altera el nº total de cromosomas, pero no el de juegos cromosómicos.
  • Poliploidía: mutación cariotípica (= cromosómica numérica) por la que aumenta el nº total de juegos cromosómicos completos.

2. Respecto a la transcripción: (a) Explique en qué consiste e indique el enzima que lleva a cabo este proceso. Cite las etapas en las que se divide este proceso (5). (b) Indique dos diferencias entre la transcripción en procariotas y en eucariotas (2). (c) Defina promotor, burbuja de transcripción e intrón (3).

(a)

  • Transcripción: proceso por el que se sintetiza ARN a partir de ADN; más en concreto, a partir de la lectura de la hebra molde de un gen.
  • ARN polimerasa.

(b)

  • En procariontes sólo interviene una ARN polimerasa; en eucariontes son 3.
  • Los genes son continuos en procariontes y discontinuos en eucariontes (tienen exones).
  • Cada ARNm transcrito en eucariontes corresponde a un sólo polipéptido (es monocistrónico), mientras que en procariontes suelen ser policistrónicos.

(c)

  • Promotor: región más allá del extremo 5' de un gen estructural, a la que se asocia la ARN-polimerasa que lo va a transcribir.
  • Burbuja de transcripción: zona desespiralizada de un gen en la que está trabajando la ARN polimerasa.

2014

1. En relación al material genético conteste a las siguientes cuestiones: (a) Defina los términos replicación semiconservativa y topoisomerasa (2). (b) Explique dos características del código genético (2). (c) Defina mutación génica y mutación cromosómica (2). (d) Indique el orgánulo y las moléculas que intervienen en el proceso de traducción y enumere sus etapas (4).

(a)

  • Replicación semiconservativa: cada una de las 2 moléculas de ADN resultantes de la replicación contiene una cadena recién sintetizada y otra cadena procedente de la molécula original.
  • Topoisomerasa: enzima que elimina los superenrollamientos que se producen en el ADN a medida que la burbuja de replicación avanza y se desenrrolla.

(b)

  • El código genético es un sistema de correspondencias entre tripletes de nucleótidos de ARNm (llamados codones) y aminoácidos.
  • Es degenerado: hay más significantes (codones) que significados (aminoácidos); dicho de otro modo, hay codones que codifican para el mismo aminoácido.
  • Es universal: salvo raras excepciones, cada codón es traducido por el mismo aminoácido en todos los seres vivos y en todas sus células.
  • Los codones de un ARNm no se solapan entre sí ni presentan espacios entre ellos.
  • Incluye codones que corresponden a "signos de puntuación": de inicio de lectura (AUG) y de fin de lectura (UAA, UAG y UGA).

(c)

  • Mutación génica: aquellas que afectan a uno o más nucleótidos o bases de un gen.
  • Mutación cromosómica: aquellas que afectan a la estructura de un cromosoma.

(d)

  • En el proceso de traducción intervienen los ribosomas (libres o unidos a la membrana nuclear o a la del retículo endoplasmático rugoso), un ARNm y los aminoacil-ARNt. Además: factores de iniciación, de elongación y de terminación, Mg2+ y GTP.
  • Iniciación, elongación y terminación.

2. En relación al proceso de replicación: (a) Realice un dibujo e identifique en él todos los componentes que participan tanto en la cadena conductora como en la retrasada (4). (b) ¿Por qué la síntesis es continua en una de las cadenas y discontinua en la otra? (2). (c) Si se produce una mutación puntual por sustitución de una base por otra distinta, ¿qué alteraciones esperaríamos encontrar? (2). (d) Cite alguna enzima que participe en la reparación del DNA y señale su función (2).

(a)

Dibujar una horquilla de replicación con: hebra conductora, hebra retrasada con 2 o más fragmentos de Okazaki y sus cebadores (numerándolos con ordinales), polimerasa de ADN, helicasa, topoisomerasas y proteínas SSB.

(b)

La replicación del ADN en cada horquilla de replicación implica la copia de ambas hebras. Pero mientras que la hebra que avanza en sentido 5' a 3' se sintetiza de forma continua (hebra conductora), la que avanza en sentido de 3' a 5' lo hace de forma discontinua (hebra retardada), debido a que la polimerasa de ADN sólo sintetiza en dirección 5' a 3'. Esto significa que se van sintetizando pequeños fragmentos en dirección 5' a 3', los fragmentos de Okazaki, que posteriormente se unirán por la acción de las ligasas.

(c)

  • Se puede producir un cambio de aminoácido en la proteína que se origina. Según el aa' forme parte del centro activo o no, o sea esencial para la conformación de la proteína o no, esto será relevante o no.
  • Se puede producir la sustitución de un codón de un aminoácido por una secuencia de terminación, por lo que el polipéptido dejaría de sintetizarse antes de tiempo y la proteína final carecerá de la función original
  • Puede que no haya efecto alguno debido a que el código genético está degenerado y un mismo aminoácido esta codificado por varios codones.

(d)

La propia ADN-polimerasa es capaz de reconocer y corregir sus propios errores, mientras está replicando el ADN, en un 99% de los casos: si ha colocado un nucleótido equivocado, su base no quedará apareada con la de la hebra complementaria; la ADN polimerasa "percibe" este desapareamiento de la base situada "a sus espaldas" y, gracias a su actividad exonucleasa, inmediatamente la sustituye por la correcta.


2013

1. En relación al material genético y su metabolismo: (a) Indique que es el código genético y explique qué quiere decir que está degenerado. (b) Defina el proceso de transcripción e indique sus etapas. (c) Indique qué son los fragmentos de Okazaki y qué enzima se encarga de su síntesis. (d) Señale las modificaciones durante la maduración de un transcrito primario de mRNA de eucariotas. (e) Escriba la secuencia de mRNA a partir de la siguiente secuencia de DNA e indique cuál es el número máximo de aminoácidos que puede codificar y explíquelo razonadamente: 3'- CCATTGGGCCACCAGGAT-5'.

(a)

  • El código genético es un sistema de correspondencias entre tripletes de nucleótidos de ARNm (llamados codones) y aminoácidos.
  • Degenerado: hay más significantes (codones) que significados (aminoácidos); dicho de otro modo, hay codones que codifican para el mismo aminoácido.

(b)

  • Transcripción: proceso por el que se sintetiza ARN a partir de ADN, con ayuda de una ARN-polimerasa.
  • Iniciación, elongación y terminación.

(c)

  • Pequeños fragmentos de ADN monocatenario sintetizados en 5' a 3', mediante los que la hebra retardada de una horquilla de replicación puede avanzar en sentido 3' a 5'.
  • ADN-polimerasa.

(d)

  • Todos los ARNm contienen intrones, porque los contenían también los genes a partir de los cuales han sido transcritos. Y hay que eliminarlos antes de que el ARNm pueda ser traducido en los ribosomas. Esto se hace en un proceso llamado maduración, que tiene 2 fases: 1º: un enzima, llamado espliceosoma, se une a los extremos de cada intrón, y lo extirpa del ARNm; 2º: una enzima ligasa empalma los exones.
  • Al extremo 5' del ARNm se le añade una caperuza formada por el nucleótido 7-metil-GTP, que permitirá el anclaje del ARNm al ribosoma para la traducción. [En rigor, ésto, auqnue es una modificación postranscripcional, no es parte de la maduración]
  • Al extremo 3' del ARNm se le añade una cola de poli-A, que es una secuencia de unos 200 AMP que ayudan a evitar su degradación rápida en el citoplasma. [En rigor, ésto, auqnue es una modificación postranscripcional, no es parte de la maduración]

(e)

  • 5'- GGUAACCCGGUGGUCCUA-3'
  • Seis: a cada triplete de nucleótidos (codón) le corresponde un aminoácido.

2. Responda sobre la traducción: (a) ¿Cuál es la función de estos elementos en dicho proceso?: Ribosoma, ARNm, ARNt, anticodón, sitio peptídico (5). (b) ¿Cuáles son las fases de dicho proceso? (3). (c) ¿Todas las proteínas recién sintetizadas en eucariotas poseen metionina en su extremo N-terminal? Razone la respuesta (2).

(a)

  • Ribosoma: es el "entorno molecular" en el que a los codones de un ARNm se le unen los aminoacil-ARNt correspondientes mediante su desplazamiento, triplete a triplete, sobre aquel.
  • ARNm: contiene una secuencia de codones (tripletes de nucleótidos) que serán traducidos a los aminoácidos de un polipéptido en el ribosoma.
  • ARNt: lleva cada aminoácido al ribosoma, para que se añada al extremo C-terminal del polipéptido en crecimiento.
  • Anticodón: triplete central del bucle central de cada ARNt, que determina qué aminoácido llevara asicoado dicho ARNt tras su activación.
  • Sitio peptídico (= sitio P): lugar del ribosoma en el que se ubica el peptidil-ARNt que se está formando. Es en este lugar que el péptido en formación recibe a un nuevo aa'.

(b)

Iniciación, elongación y terminación. [Describir brevemente.]

(c)

Sí, porque el codón iniciador de la traducción, AUG, codifica para la metionina en eucariontes. En el 95% de los casos (19/20), será eliminado durante las modificaciones postraduccionales.


2012

1. En relación con la información genética y sus alteraciones: (a) Si un polipéptido tiene 110 aminoácidos, indica cuántos nucleótidos tendrá el fragmento del ARNm que codifica a esos aminoácidos. Razone la respuesta (1). (b) ¿Qué significa que el código genético está degenerado? (1). (c) En un fragmento de ADN que codifica a un polipéptido se produce una mutación puntual, que afecta a un par de bases. Cuando la célula sintetice el polipéptido, a éste le podría haber ocurrido uno de los cuatro hechos de más abajo. Basándote en tus conocimientos del código genético, explica por qué puede darse cada uno de estos resultados (8): (i) Que se codifique el mismo aminoácido que el sintetizado antes de la mutación. (ii) Que un aminoácido sea sustituido por otro. (iii) Que el nuevo polipéptido sintetizado sea más corto. (iv) Que el nuevo polipéptido sintetizado sea más largo.

(a)

330 (si es un ARNm maduro) ya que cada aa' es codificado por un triplete de nucleótidos de ARNm, según el código de correspondencias llamado código genético.

(b)

Degenerado: hay más significantes (codones) que significados (aminoácidos); dicho de otro modo, hay codones que codifican para el mismo aminoácido.

(c)

  • i. Muchos de los 20 aa' están codificados por más de un codón ("código degenerado"); si esta mutación es una sustitución, puede haberse cambiado un codón por otro que codifique para el mismo aa'.
  • ii. La mutación sigue siendo una sustitución, pero esta vez el nuevo codón codifica para un aa' diferente.
  • iii, iv. Por ejemplo, por una delección o una adición. Ambas provocan un corrimiento en el orden de lectura, que hace que el codón de terminación (UAA, UAG o UGA) original "desaparezca" y aparezca otro nuevo en una posición anterior (caso 3) o posterior (caso 4).

2. (a) Indique las funciones de las siguientes enzimas que participan en la replicación del ADN: helicasa y topoisomerasa (2). (b) ¿Qué es la transcripción? Indique y explique brevemente sus etapas (5). (c) Transcriba la siguiente secuencia de ADN (2): 5'- GCCGTATGCCCATAG-3'. (d) ¿Qué nombre reciben las secuencias de inicio a las que se une la ARN polimerasa? (1).

(a)

  • Helicasa: enzima que hace avanzar una horquilla de replicación, rompiendo los puentes de H entre las bases complementarias de esta región, y separando así las 2 hebras de la molécula de ADN.
  • Topoisomerasa: enzima que elimina los superenrollamientos que se producen en el ADN a medida que la burbuja de replicación avanza y se desenrrolla.

(b) Visto.

(c) 3'-CGGCAUACGGGUAUC-5'

(d) Región promotor (del operón).


2011

1. Observa el siguiente segmento de ADN: (a) Escribe la molécula de ARN que se transcribiría a partir de este segmento. Considera que la ARN polimerasa usa la hebra superior como molde cuando va a sintetizar ARN. Marca los extremos 5' y 3' del ARN (2). (b) Consultando el código genético, escribe la secuencia de aminoácidos que se produciría al traducir este ARN. Marca los extremos carboxilo y amino de este péptido (2). (c) Repite la operación asumiendo ahora que la hebra usada como molde por la ARN polimerasa es la inferior (4). (d) Con esta información, ¿Podrías saber a ciencia cierta cuál de las dos cadenas de este fragmento de ADN se usa como molde? Explica por qué (2).

(a) 5' UUGGGAAGC 3'

(b) N - Leu Gly Ser - C

(c)

  • 5' GCUUCCCAA 3'
  • N - Ala Ser Gln - C

(d) Puede ser cualquiera y aquí no se puede deducir, ya que este fragmento es pequeño y no contiene codones de inicio de la traducción o de parada en ninguno de los dos casos, que pudieran servir de pista.

2. (a) Dado el siguiente fragmento de ADN monocatenario 3'…TAC GGA GAT TCA AGA GAG …5' y del correspondiente ADN mutante 3'… TAC GGG ATT CAA GAG AG…5' ¿Qué tipo de mutación se ha producido? (3). (b) ¿La mutación incluida en el apartado (a) puede conllevar alteraciones graves? Razona la respuesta (2). (c) Indicar qué son las aneuploidías y euploidías (2). (d) Pon tres ejemplos de agentes mutágenos exógenos (3).

(a) Una deleción del 6º nucleótido (A).

(b) Es una mutación grave, ya que se produce un corrimiento en el orden de lectura y, por tanto, se alteran todos los tripletes siguientes, incluido el de fin de la traducción: la proteína resultante tendrá diferentes aa' que la original y en diferente nº (muy probablemente), y carecerá de la función original.

(c)

  • Aneuploidía: mutación cariotípica (= cromosómica numérica) por la que se altera el nº total de cromosomas, pero no el de juegos cromosómicos.
  • Euploidía: mutación cariotípica (= cromosómica numérica) por la se altera el nº total de juegos cromosómicos completos.

(d) Las radiaciones ionizantes (como los rayos X, partículas a, partículas b y rayos g), la radiación ultravioleta, los ultrasonidos, agentes químicos (HNO2, las acridinas, el gas mostaza, la nicotina, y diversos fármacos y pesticidas), virus (retroviris, hepatitis B...).